Table 2

Primers used for amplification and sequencing of the ND4 mitochondrial DNA fragment
Species or groups of species with their forward and reverse primers Source
T. marmoratus
MARF1: CACCTGTGATTACCTAAAGCTCATGTAGAAGC This study
ND4R2: CCCTGAAATAAGAGAGGGTTTAA [33]
T. pygmaeus
PYGF1: CACCTCTGATTGCCTAAAGCCCACGTAGAGGC This study
ND4R2: CCCTGAAATAAGAGAGGGTTTAA [33]
T. karelinii group of crested newts
KARF4: AGCGCCTGTCGCCGGGTCAATA [33]
KARR1: AACTCTTCTTGGTGCGTAG [33]
Other crested newts
KARF4: AGCGCCTGTCGCCGGGTCAATA [33]
DOBR2: GTGTTTCATAACTCTTCTTGGT [33]

Wielstra et al.

Wielstra et al. Frontiers in Zoology 2013 10:13   doi:10.1186/1742-9994-10-13

Open Data